Selection of RNA-aptamers as anti-malaria agents
Inventors
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-9309516-B2
Publication Date
2016-04-12
Expiration Date
Abstract
The present invention relates to an aptamer or an active fragment thereof raised against the semi-conserved duffy binding ligand domain 1α, DBL1α, region of the Plasmodium falciparum erythrocyte membrane protein 1, PfEMPI, which aptamer has an effect against malaria, in particular severe cerebral malaria.
Core Innovation
The invention describes RNA aptamers selected against a semi-conserved DBL1α region of PfEMP1 from Plasmodium falciparum. The aptamers are used as anti-malaria agents, including for severe cerebral malaria, and the background problem addressed is malaria with a focus on targeting DBL1α within PfEMP1.
The document states that aptamers are selected using SELEX and includes 2′F-modified aptamers and fluorinated/modified sequences. It reports identification of conserved sequence groups and multiple specific aptamers, including sequences associated with SEQ ID NOs 1–6 and fluorinated/modified sequences associated with SEQ ID NOs 7–12.
The aptamers are characterized by binding to recombinant DBL1α and to live infected erythrocytes, and are reported to disrupt rosetting/cytoadherence in FCR3S1.2 cultures. The document also reports stability in serum and describes use for treatment by administering aptamers for severe malaria and for diagnosis by assessing blood response to DBL1α aptamers.
Claims Coverage
The partial claim set provided includes two independent claims. The claim coverage centers on sequence-defined aptamers against DBL1α/PfEMP1, including one fluorinated aptamer defined by a fluorinated nucleotide sequence, with dependent claims specifying the aptamer consists of particular SEQ ID numbers.
Sequence-defined RNA aptamer
An aptamer comprising a specific RNA sequence defined as (SEQ ID NO: 4) with the nucleotides UAGCUCACCACACCAGCAAUCAACGCGUUUUUUCAAACACUGGCACAUGA.
Fluorinated aptamer of a defined sequence
A fluorinated aptamer of SEQ ID NO: 4 having a specified fluorinated nucleotide sequence corresponding to (SEQ ID NO: 10).
Across the provided independent claims, the inventive subject matter is directed to sequence-defined aptamers against DBL1α/PfEMP1, including a fluorinated variant defined by a specified fluorinated nucleotide sequence, with dependent claims further narrowing the aptamer to consist of particular SEQ ID numbers.
Stated Advantages
The aptamers bind to recombinant DBL1α and to live infected erythrocytes.
The aptamers disrupt rosetting/cytoadherence in FCR3S1.2 cultures.
The aptamers are stable in serum.
Documented Applications
Treatment of severe malaria by administering the aptamers.
Diagnosis by assessing blood response to DBL1α aptamers.
Interested in licensing this patent?