Selection of RNA-aptamers as anti-malaria agents
Inventors
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-9096857-B2
Publication Date
2015-08-04
Expiration Date
Abstract
The present invention relates to an aptamer or an active fragment thereof raised against the semi-conserved duffy binding ligand domain 1α, DBL1α, region of the Plasmodium falciparum erythrocyte membrane protein 1, PfEMPI, which aptamer has an effect against malaria, in particular severe cerebral malaria.
Core Innovation
The invention relates to RNA aptamers selected by SELEX against the semi-conserved DBL1α region of PfEMP1 from Plasmodium falciparum. The selected aptamers include sequence-defined aptamers and fluorinated variants, including SEQ ID NOs: 1–6, SEQ ID NOs: 7–12, and fragments such as SEQ ID NO:23, and are defined as binding to recombinant DBL1α.
The aptamers associate with live infected erythrocytes and disrupt rosetting in vitro. Particular aptamer clones, including b02, d12, and e05, show complete rosette disruption in an in vitro assay, with effects also observed at lower concentrations, and the aptamers are connected to cytoadherence involving PfEMP1/DBL1α.
The disclosure further states that 2′F-modified fluorinated aptamers exhibit serum stability. The document also frames use of the aptamers for anti-cerebral/severe malaria treatment and for diagnosis by assessing a blood-sample response to DBL1α aptamers.
Claims Coverage
The partial claim set includes four independent claims, each directed to sequence-defined aptamers and fluorinated variants corresponding to SEQ ID NO:5 and SEQ ID NO:11. Across these independent claims, the inventive coverage is concentrated on exact nucleotide sequence identity and, for some claims, fluorination of the aptamer sequence.
Sequence-defined aptamer
An aptamer consisting of the sequence AACAAUACGACUACACCAUCAAAAGUAUUAUCUUGCAUCGAAGGUUGGCA (SEQ ID NO:5).
Fluorinated aptamer of SEQ ID NO:5 with sequence set forth as SEQ ID NO:11
A fluorinated aptamer of SEQ ID NO:5 having sequence AAC F AAU F AC F GAC F U F AC F AC F C F AU F C F AAAAGU F AU F U F AU F C F U F U F GC F AU F C F GAAGG U F U F GGC F A (SEQ ID NO:11).
Aptamer comprising SEQ ID NO:5 polynucleotide
An aptamer comprising a polynucleotide having SEQ ID NO:5.
Fluorinated aptamer SEQ ID NO:5 comprising SEQ ID NO:11 polynucleotide sequence
A fluorinated aptamer SEQ ID NO:5, comprising a polynucleotide sequence having SEQ ID NO:11.
The independent claims primarily cover aptamers defined by exact nucleotide sequence identity using SEQ ID NO:5, including a fluorinated variant presented as SEQ ID NO:11 and explicitly linked to a fluorinated form of SEQ ID NO:5.
Stated Advantages
Aptamers bind recombinant DBL1α and associate with live infected erythrocytes.
Aptamers disrupt rosetting in vitro.
2′F-modified fluorinated aptamers exhibit serum stability.
Aptamers are framed for anti-cerebral/severe malaria treatment.
Aptamers are framed for diagnosis by assessing a blood-sample response to DBL1α aptamers.
Documented Applications
Anti-cerebral/severe malaria treatment using DBL1α aptamers.
Diagnosis by assessing a blood-sample response to DBL1α aptamers.
Interested in licensing this patent?