Compositions and methods using siRNA molecules and siRNA cocktails for the treatment of breast cancer
Inventors
Lu, Patrick Y. • Evans, David • Xu, Jun John
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-9012622-B2
Publication Date
2015-04-21
Expiration Date
Abstract
The present invention provides small interfering RNA (siRNA) molecules, compositions containing the molecules, and methods of using the molecules and compositions to treat breast cancer. In one aspect, a multi-targeted siRNAi cocktail is disclosed. The siRNA molecules may be encapsulated in nanoparticles to further enhance their anti-cancer activity. The compositions may also be used in combination with other anti-cancer agents, such as bevacizumab.
Core Innovation
The invention relates to RNA interference (RNAi) breast-cancer treatment using a multi-targeted siRNA cocktail. The siRNA molecules silence oncogenic pathways associated with breast cancer by targeting EGFR, Raf-1, and mTOR. The disclosed siRNAs are provided as isolated siRNA molecules defined by specific sense strand sequences.
The invention further provides formulations for delivery of the multi-targeted siRNA cocktail using pharmaceutically acceptable carriers. A histidine-lysine polymer (HKP)-based self-assembled nanoparticle formulation is described, including embodiments with a carrier and, optionally, a targeting ligand to enhance delivery. The patent also addresses using human/mouse-homologous mRNA targeting to reduce species specificity and cytokine cross-reactivity.
The patent additionally describes immune-stimulatory motif considerations within the siRNA design space, including motifs such as UGUGU, GUCCUUCAA, and CpG. The approach is described as supporting multi-gene inhibition, including a tri-gene siRNA cocktail targeting EGFR, Raf-1, and mTOR, and combination therapy with bevacizumab in the context of breast-cancer treatment.
Claims Coverage
The independent claims cover five inventive features: isolated siRNA sequences, a three-siRNA pharmaceutical composition, a nanoparticle formulation, and dual-species binding requirements for 25 mer siRNAs. Across the claims, the inventive features are organized around specific siRNA sequences, multi-target inclusion of EGFR, Raf-1, and mTOR, and formulation/delivery elements including a carrier and targeting ligand.
Isolated Raf-1 and mTOR siRNA sequences
An isolated siRNA selected from the group consisting of 5′-r(CCUGUGGCUACAAGUUCCACCAGCA)-3′ (SEQ ID NO. 62) (sense strand sequence, Raf-1), and 5′-r(CACUACAAAGAACUGGAGUUCCAGA)-3′ (SEQ ID NO. 94) (sense strand sequence, mTOR).
Three siRNAs targeting EGFR, Raf-1, and mTOR in a carrier
A composition comprising the three different isolated siRNA molecules selected from the group consisting of 5′-r(CCUGUGGCUACAAGUUCCACCAGCA)-3′ (SEQ ID NO. 62) (sense strand sequence, Raf-1), 5′-r(CACUACAAAGAACUGGAGUUCCAGA)-3′ (SEQ ID NO. 94) (sense strand sequence, mTOR), and 5′-r(GAUCAUGGUCAAGUGCUGGAUGAUA)-3′ (SEQ ID NO. 38) (sense strand sequence, EGFR) and a pharmaceutically acceptable carrier.
Nanoparticle with three siRNAs, carrier, and targeting ligand
A nanoparticle comprising the three different isolated siRNA molecules selected from the group consisting of 5′-r(CCUGUGGCUACAAGUUCCACCAGCA)-3′ (SEQ ID NO. 62) (sense strand sequence, Raf-1), 5′-r(CACUACAAAGAACUGGAGUUCCAGA)-3′ (SEQ ID NO. 94) (sense strand sequence, mTOR), and 5′-r(GAUCAUGGUCAAGUGCUGGAUGAUA)-3′ (SEQ ID NO. 38) (sense strand sequence, EGFR), a carrier, and a targeting ligand.
25 mer dual-species Raf-1 or mTOR binding siRNA
An isolated 25 mer siRNA molecule selected from the group consisting of a molecule that binds to an mRNA molecule that encodes human Raf-1 and binds to an mRNA molecule that encodes mouse Raf-1; and a molecule that binds to an mRNA molecule that encodes human mTOR and binds to an mRNA molecule that encodes mouse mTOR wherein said molecule is selected from the group consisting of 5′-r(CCUGUGGCUACAAGUUCCACCAGCA)-3′ (SEQ ID NO. 62) (sense strand sequence, Raf-1), and 5′-r(CACUACAAAGAACUGGAGUUCCAGA)-3′ (SEQ ID NO. 94) (sense strand sequence, mTOR).
25 mer dual-species EGFR, Raf-1, and mTOR binding siRNA composition
A composition comprising the three different isolated 25 mer siRNA molecules selected from the group consisting of a molecule that binds to an mRNA molecule that encodes human EGFR and binds to an mRNA molecule that encodes mouse EGFR; a molecule that binds to an mRNA molecule that encodes human Raf-1 and binds to an mRNA molecule that encodes mouse Raf-1; and a molecule that binds to an mRNA molecule that encodes human mTOR and binds to an mRNA molecule that encodes mouse mTOR, wherein said molecule is selected from the group consisting of 5′-r(GAUCAUGGUCAAGUGCUGGAUGAUA)-3′ (SEQ ID NO. 38) (sense strand sequence, EGFR), 5′-r(CCUGUGGCUACAAGUUCCACCAGCA)-3′ (SEQ ID NO. 62) (sense strand sequence, Raf-1), and 5′-r(CACUACAAAGAACUGGAGUUCCAGA)-3′ (SEQ ID NO. 94) (sense strand sequence, mTOR) and a pharmaceutically acceptable carrier.
Overall, the independent claims cover isolated Raf-1 and mTOR siRNA sequences, a three-siRNA EGFR/Raf-1/mTOR composition in a pharmaceutically acceptable carrier, and a nanoparticle formulation including the same three siRNAs with a carrier and a targeting ligand. Additional independent claim coverage requires 25 mer siRNAs that bind to both human and mouse mRNA for Raf-1 or mTOR, and for EGFR, Raf-1, and mTOR in a single carrier-containing composition.
Stated Advantages
Reduced proliferation (Ki-67) in tumor tissue.
Increased apoptosis (TUNEL) in tumor tissue.
Tumor growth inhibition.
Synergistic effects reported for tri-gene siRNA cocktails versus single/double siRNAs.
Synergy with bevacizumab.
Documented Applications
Breast-cancer treatment using a multi-targeted siRNA cocktail targeting EGFR, Raf-1, and mTOR, including combination therapy with bevacizumab.
Interested in licensing this patent?