Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.

Publication Number

US-8865672-B2

Patent

Publication Date

2014-10-21

Expiration Date

2027-10-05


Abstract

Provided herein are methods for preventing, ameliorating, and/or reducing tissue ischemia and/or tissue damage due to ischemia, increasing blood vessel diameter, blood flow and tissue perfusion in the presence of vascular disease including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke and influencing other conditions, by suppressing CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows for control of blood vessel diameter and blood flow, and permits modification of blood pressure and cardiac function. Under conditions of decreased blood flow, for instance through injury or atherosclerosis, blocking TSP1-CD47 interaction allows blood vessels to dilate and increases blood flow, tissue perfusion and tissue survival.

Core Innovation

The invention provides methods for preventing, ameliorating, or reducing tissue ischemia and tissue damage due to ischemia by suppressing CD47 and/or blocking thrombospondin-1 (TSP1) and/or CD47 activity or interaction. By influencing the interaction of CD47-TSP1 in blood vessels, blood vessel diameter and blood flow can be controlled, permitting modification of blood pressure and cardiac function. Blocking TSP1-CD47 interaction allows blood vessels to dilate, increasing blood flow, tissue perfusion, and tissue survival under conditions of decreased blood flow such as injury or atherosclerosis.

The problem being solved is the disruption of adequate blood flow to organs and tissues, which leads to diseases including peripheral vascular disease, ischemic heart disease, stroke, and diabetes, causing tissue death and wound healing problems during and after surgery. Existing treatments such as hyperbaric oxygen, intravenous thrombolytics, anti-inflammatory agents, and angiogenesis promoters have had limited success in resolving ischemia.

The invention also discloses that TSP1 blocks the effects of bioactive nitric oxide (NO) in the vascular system by preventing NO-induced dilation of blood vessels, acting through the cell receptor CD47. Relief of this inhibition in genetically altered mice lacking TSP1 or CD47 or by using reagents that block TSP1-CD47 interaction dramatically improves blood flow and tissue oxygenation. Therapeutic compounds include anti-CD47 antibodies, anti-TSP1 antibodies, morpholinos targeting CD47 or TSP1, and peptides derived from TSP family members or CD47 ligands.

Claims Coverage

The patent includes multiple independent claims focusing on methods to increase tissue perfusion, prevent ischemic tissue damage, improve graft survival, and treat ischemia by administering oligonucleotides or analogs targeting CD47 mRNA under high stringency, often in the form of antisense morpholinos.

Use of antisense morpholino oligonucleotides against CD47 mRNA

Administering a therapeutically effective amount of an antisense morpholino oligonucleotide of about 15 to 300 bases that specifically hybridizes to the mRNA of CD47, with particular sequences such as CGTCACAGGCAGGACCCACTGCCCA (SEQ ID NO: 21) or close variants thereof.

Increasing tissue perfusion via CD47 targeting

Methods comprising selecting subjects in need of increased tissue perfusion, such as those with ischemia, vascular diseases, or undergoing surgeries, and administering the antisense morpholino to increase tissue perfusion and survival.

Combination therapies with NO donors or modulators

Administering the CD47 targeted oligonucleotide or analog in combination with therapeutically effective amounts of nitric oxide donors or precursors, activators of soluble guanylyl cyclase (sGC), or cyclic nucleotide phosphodiesterase inhibitors to enhance therapeutic effect.

Use of CD47 targeting agents in organ and tissue transplantation

Administering the antisense morpholino or analog to donor organs or tissues before transplantation to improve survival and treatment outcomes.

Application in treatment of ischemic injury and related conditions

Treating subjects with or at risk of ischemic injury including peripheral vascular disease, myocardial infarction, stroke, sickle cell anemia, diabetes-related ischemia, burns, non-healing wounds, and other vasculopathies using CD47 targeted oligonucleotides.

The claims cover methods using antisense morpholino oligonucleotides targeting CD47 mRNA to increase tissue perfusion, prevent ischemic injury, improve graft and organ transplant survival, and treat ischemic and vascular diseases, often in combination with NO-related treatments or as coatings on implants such as vascular stents.

Stated Advantages

Increased blood flow, tissue perfusion, and tissue survival in ischemic conditions.

Improved tissue and skin graft survival, including in burns and surgical reconstructive procedures.

Alteration of platelet function to modulate blood clot formation and prevent excessive bleeding.

Potential to supplement treatments for a range of vascular pathologies including peripheral vascular disease, atherosclerosis, coronary artery disease, stroke, diabetes, and age-related vasculopathies.

Ability to enhance nitric oxide signaling effects through targeted blocking of TSP1 and CD47.

Therapeutic agents can be delivered locally to maximize efficacy and minimize systemic side effects.

Documented Applications

Treatment of tissue ischemia and tissue damage due to ischemia in diseases including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke, diabetes, and wounds from surgery or burns.

Improvement of tissue survival in skin grafts, including full thickness skin grafts, and wound bed treatment during reconstructive surgery and transplantation.

Use in ameliorating reperfusion injury following cardiac ischemia, bypass surgery, and organ transplantation.

Treatment of vascular dysfunction and blood flow regulation in elderly subjects, including improvement of blood flow and wound healing in aged tissues.

Modulation of blood clotting and platelet aggregation to reduce bleeding or prevent thrombosis.

Potential topical applications for wound healing, burn treatment, and acute trauma care including battlefield injuries.

Incorporation of therapeutic agents into implantable devices such as vascular stents for sustained regional treatment.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.