Prevention of tissue ischemia and related compositions

Inventors

Isenberg, Jeffrey S.Roberts, David D.

Assignees

Washington University in St Louis WUSTLUS Department of Health and Human Services

Publication Number

US-8557788-B2

Publication Date

2013-10-15

Expiration Date

2027-10-05

Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.


Abstract

Provided herein are compositions for preventing, ameliorating, and/or reducing tissue ischemia and/or tissue damage due to ischemia, increasing blood vessel diameter, blood flow and tissue perfusion in the presence of vascular disease including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke and influencing other conditions, by suppressing CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows for control of blood vessel diameter and blood flow, and permits modification of blood pressure and cardiac function. Under conditions of decreased blood flow, for instance through injury or atherosclerosis, blocking TSP1-CD47 interaction allows blood vessels to dilate and increases blood flow, tissue perfusion and tissue survival.

Core Innovation

Provided are compositions and methods for preventing, ameliorating, and reducing tissue ischemia and tissue damage due to ischemia, by increasing blood vessel diameter, blood flow, and tissue perfusion through suppression of CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows control of blood vessel diameter and blood flow, modifying blood pressure and cardiac function. Blocking TSP1-CD47 interaction under decreased blood flow conditions, such as injury or atherosclerosis, permits blood vessel dilation, increased blood flow, tissue perfusion, and tissue survival.

The problem solved relates to inadequate blood flow and perfusion leading to morbidity and mortality in diseases including peripheral vascular disease, ischemic heart disease, stroke, and diabetes, as well as tissue death and wound healing problems during and after surgery. Existing treatments including hyperbaric oxygen, intravenous thrombolytics, anti-inflammatory agents, and local angiogenesis promoters have yielded limited success. It was unknown how to effectively increase blood flow and tissue survival by modulating molecular pathways.

The inventors discovered that the matrix protein thrombospondin-1 (TSP1) blocks the effects of nitric oxide (NO) in the vascular system, preventing NO-induced vasodilation and increased blood flow. TSP1 acts through the cell receptor CD47 to block NO effects. Genetic knockout mice lacking TSP1 or CD47 show dramatically improved blood flow and tissue oxygenation. Reagents like monoclonal antibodies, peptides that block TSP1-CD47 interaction, or agents reducing CD47 or TSP1 expression dramatically increase blood flow to ischemic tissues.

Claims Coverage

The patent contains independent claims directed to CD47 antisense oligonucleotide analogs and pharmaceutical compositions comprising them.

CD47 oligonucleotide analog with specific sequence and chemical modifications

A CD47 oligonucleotide analog up to 50 nucleotides long, comprising the sequence CGTCACAGGCAGGACCCACTGCCCA (SEQ ID NO: 21), and including altered sugar moieties, inter-sugar linkages, non-naturally occurring nucleotide linkages, phosphorothioate oligodeoxynucleotides, peptide nucleic acids (PNAs), morpholinos, or combinations thereof.

Pharmaceutical compositions limiting CD47 expression

Pharmaceutical compositions comprising the CD47 oligonucleotide analog and a suitable delivery vehicle, which limit tissue expression of CD47 when administered to tissue.

Antisense morpholino targeting CD47

Antisense morpholino oligonucleotide that binds specifically to nucleic acid encoding CD47, comprising the sequence CGTCACAGGCAGGACCCACTGCCCA (SEQ ID NO: 21), and pharmaceutical compositions thereof.

The claims cover antisense oligonucleotide analogs and morpholinos targeting CD47 mRNA to limit CD47 expression in tissues, including pharmaceutical compositions comprising these agents and appropriate delivery vehicles.

Stated Advantages

Increasing blood flow to ischemic tissues by modulating TSP1-CD47 interaction promotes tissue perfusion and survival.

Targeting TSP1 or CD47 can improve tissue survival and blood flow in acute and chronic ischemic conditions.

Therapeutics that block TSP1-CD47 can enhance survival of skin grafts, ischemic flaps, and reduce tissue necrosis.

Therapeutics modulating TSP1-CD47 interaction can prevent platelet aggregation inhibition by NO, thus influencing blood clotting.

Therapeutics directed to TSP1-CD47 interaction may help ameliorate deleterious effects of aging on blood flow and tissue survival.

Documented Applications

Prevention and treatment of tissue ischemia and ischemic tissue damage due to vascular diseases including peripheral vascular disease, atherosclerosis, coronary artery disease, stroke, diabetes, and associated surgical trauma or burn injury.

Increasing blood flow, tissue perfusion and survival in ischemic soft tissues, including in random cutaneous and myocutaneous flaps, full thickness skin grafts, and hindlimbs of mammals.

Modulation and enhancement of skin graft and soft tissue flap survival during surgery, reconstructive surgery, limb reattachment, burns, and wound healing.

Improving tissue and organ perfusion and survival during organ transplantation and cardiovascular surgery.

Modulating platelet function and hemostasis, including increasing or decreasing the tendency of platelets to form aggregates and thrombotic clots, useful in stroke, coronary artery disease, bleeding disorders, and trauma.

Therapeutic methods to improve tissue perfusion and survival in elderly subjects and subjects with age-related vasculopathies, including atherosclerosis and dementia.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.