Modulation of gene transcription using antisense oligonucleotides targeting regulatory RNAs
Inventors
Sehgal, Alfica • Matthews, Bryan J. • Bumcrot, David A. • Caravella, Justin A. • Gamboa, Mario Esteban Contreras • Kelkar, Rachana S. • Jung, Yun Joon • Liu, Yuting • Pai, Rutuja Sudhakar • Roy, Subhadeep • Guo, Yuchun
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-12319916-B2
Publication Date
2025-06-03
Expiration Date
Abstract
Described herein are methods of modulating gene transcription using antisense oligonucleotides (ASOs) targeting regulatory RNAs, such as promoter-associated RNAs and enhancer RNAs. These methods are useful for modulating the levels of gene products, for example, increasing expression of Carbamoyl-Phosphatase Synthetase 1 (CPS1), thereby treating diseases associated with aberrant gene expression.
Core Innovation
The invention relates to antisense oligonucleotide (ASO)-mediated upregulation of carbamoyl-phosphate synthetase 1 (CPS1) regulatory RNAs, including enhancer RNAs (eRNAs) and promoter-associated RNAs (paRNAs). The approach provides ASOs that are complementary to CPS1 regRNA targets, and identifies conserved CPS1 enhancer regulatory RNAs (RR44_v1 and RR44_v2) linked to CPS1 enhancer activity and CPS1 expression.
The ASOs are targeted to CPS1 regRNA regions positioned within a limited distance from the 5′ end or the 3′ end, and the disclosure includes designed and screened CPS1-targeting ASOs such as hCPS1-ASO-1a and hCPS1-ASO-1x. The disclosed design scope includes chemically modified nucleotides, 2′-O-alkyl sugars such as 2′-MOE and locked nucleic acid (LNA), 5-methylcytidine, and phosphorothioate and phosphodiester linkages.
The invention further includes optional conjugates, including a biotin moiety and ligand moieties including GalNAc and GalNAc3. The patent frames use for increasing CPS1 transcription/expression and increasing CPS1 regRNA amount and stability, including treatment of urea cycle disorders such as CPS1 deficiency and hyperammonemia.
Claims Coverage
The partial content includes three independent claims. Across these claims, the inventive coverage centers on a specific CPS1-target ASO sequence with chemical modifications, a defined chemically modified ASO backbone with a triethyleneglycol-linked GalNAc ligand moiety, and an additional defined chemically modified ASO sequence/backbone with optional 3′-end ligand conjugation and GalNAc/GalNAc3 variants.
Defined ASO sequence with chemically modified nucleotides
An antisense oligonucleotide (ASO) comprising a nucleotide sequence of TGCAGGCACACACATCAGGC (SEQ ID NO: 1), wherein one or more of the nucleotides of the ASO are chemically modified.
Chemically defined ASO backbone with triethyleneglycol-linked GalNAc ligand moiety
An antisense oligonucleotide (ASO) comprising MT=MG=M5C-MA-MG=dG=d5C=dA=d5C=dA=d5C-dA=d5C-dA=dT=M5C-MA-MG=MG=M5C-[TEG] (SEQ ID NO: 409), wherein MT, MG, MA, and M5C are 2′-O-methoxyethyl thymidine, 2′-O-methoxyethyl guanosine, 2′-O-methoxyethyl adenosine, and 2′-O-methoxyethyl 5-methyl cytidine ribonucleosides; dA, dG, dT, and d5C are 2′-deoxy adenosine, 2′-deoxy guanosine, 2′-deoxy thymidine and 2′-deoxy 5-methyl cytidine ribonucleosides, “=” is a phosphorothioate linkage, “-” is a phosphodiester linkage, and [TEG] is a ligand moiety comprising a triethyleneglycol linked to N-acetylgalactosamine (GalNAc).
Chemically defined ASO backbone with phosphorothioate/phosphodiester linkages
An antisense oligonucleotide (ASO) comprising MT=MG=M5C-MA-MG-dG=d5C=dA=d5C=dA=d5C=dA=dT=M5C-MA-MG-MG=M5C (SEQ ID NO: 404), wherein MT, MG, MA, and M5C are 2′-O-methoxyethyl thymidine, 2′-O-methoxyethyl guanosine, 2′-O-methoxyethyl adenosine, and 2′-O-methoxyethyl 5-methyl cytidine ribonucleosides; dA, dG, dT, and d5C are 2′-deoxy adenosine, 2′-deoxy guanosine, 2′-deoxy thymidine and 2′-deoxy 5-methyl cytidine ribonucleosides, “=” is a phosphorothioate linkage, and “-” is a phosphodiester linkage.
Overall, the claim coverage in the partial content targets specific ASO sequences and backbones with corresponding chemical modification patterns, with dependent refinements that include 3′-end ligand moiety conjugation and ligand variants such as GalNAc and GalNAc3, as well as pharmaceutical compositions containing the claimed ASOs.
Stated Advantages
Increasing CPS1 transcription/expression.
Increasing CPS1 regulatory RNA (regRNA) amount and stability.
Upregulation of CPS1 regulatory RNAs (including enhancer RNAs and promoter-associated RNAs).
Treatment of urea cycle disorders, including CPS1 deficiency and hyperammonemia.
Upregulates CPS1 mRNA and increases ureagenesis in donor-derived hepatocytes.
Increases hepatic CPS1 and other urea-cycle genes while reducing plasma ammonia.
Does not alter neighboring gene expression.
Provides a duration of action of approximately four weeks.
Demonstrates efficacy in OTC-deficient mouse and humanized liver models and in non-human primates, including decreased ammonia production and increased urea output.
Documented Applications
Increasing CPS1 transcription/expression in human hepatocytes.
Increasing CPS1 regRNA amount and stability.
Treating urea cycle disorders including CPS1 deficiency and hyperammonemia.
Treatment/evaluation context for OTC-deficient conditions, including OTC-deficient mice and OTC-deficient donor hepatocytes, using GalNAc-conjugated CPS1 regRNA-targeting ASOs to reduce plasma ammonia and improve ureagenesis.
Evaluation in humanized liver models (Yecuris FRG humanized mice) using CPS1 regRNA-targeting ASOs to increase urea-cycle gene expression and reduce ammonia.
Evaluation in non-human primates (cynomolgus monkeys) using hCPS1-ASO-1x, including effects on ammonia production and enhanced ureagenesis with 13C-sodium acetate co-challenge.
Interested in licensing this patent?