Compositions and methods for treating endometriosis

Inventors

Taylor, Hugh

Assignees

Yale University

Publication Number

US-12286629-B2

Publication Date

2025-04-29

Expiration Date

2039-07-12

Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.


Abstract

The invention includes compositions and methods for the treating or preventing endometriosis in a subject in need thereof. In one aspect, the invention relates to compositions and methods for modulating let-7 microRNA.

Core Innovation

The invention provides compositions and methods for treating or preventing endometriosis by modulating let-7 microRNAs, particularly by administering an activator of let-7 miRNA to a subject in need. One embodiment features the use of a let-7b mimic, specifically the sequence UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO:9), as the activator. This approach is designed to increase the expression or activity of let-7b or related let-7 miRNAs in order to achieve therapeutic benefits in endometriosis.

The problem addressed by this invention is the limitation and significant side effects of current endometriosis treatments, which are largely focused on hormonal manipulation and are contraindicated for women wishing to conceive. The pathophysiology of endometriosis is incompletely understood, but miRNAs, including let-7 family members, have been implicated in the disease and are abnormally expressed in endometriosis tissue.

The invention demonstrates that increasing let-7b miRNA activity through administration of a let-7b mimic reduces lesion growth in endometriosis and suppresses key genes involved in the disease's pathophysiology, such as ER-α, ER-β, Cyp19a, KRAS 4A, KRAS 4B, and IL-6. These findings provide a novel, non-hormonal approach to endometriosis therapy that targets underlying molecular mechanisms and avoids systemic hormonal side effects.

Claims Coverage

The patent contains one independent claim, which sets forth the main inventive feature for treating endometriosis using a defined let-7b mimic and a specific administration protocol.

Method of treating endometriosis with a let-7b mimic administered intraperitoneally

The method comprises: - Administering to a subject with endometriosis an effective amount of an activator of a let-7 microRNA (miRNA). - The activator is a let-7b mimic having the sequence UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO:9). - The activator is administered to the subject by intraperitoneal injections every three days for two weeks. This method is explicitly defined by the composition (let-7b mimic with the given sequence) and route/frequency/duration of administration.

The independent claim broadly covers the method of treating endometriosis by intraperitoneal administration of a specific let-7b mimic sequence, delineating both the molecular feature and the treatment regimen.

Stated Advantages

The treatment simultaneously affects multiple pathways driving endometriosis, including estrogen signaling, growth factor receptors, and inflammation, without systemic hormonal side effects.

Let-7b treatment results in reduced endometriosis lesion size and decreased expression of several key genes known to promote endometriosis growth.

Provides a novel, non-hormonal therapy for endometriosis that targets disease molecular mechanisms directly, offering a more comprehensive and potentially safer alternative to current drug therapies.

Documented Applications

Treating or preventing endometriosis in a subject in need thereof.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.