Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy

Inventors

Subramanian, Romesh R. • Qatanani, Mohammed T. • Weeden, Timothy

Assignees

Dyne Therapeutics Inc

Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.

Publication Number

US-12263225-B2

Patent

Publication Date

2025-04-01

Expiration Date


Abstract

Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload promotes the expression or activity of a functional dystrophin protein. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide, e.g., an oligonucleotide that causes exon skipping in a mRNA expressed from a mutant DMD allele.

Core Innovation

The disclosure concerns a composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide. The antibody comprises human or humanized framework regions, including heavy chain variable region and light chain variable region, and binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1. The antibody-oligonucleotide architecture supports receptor-mediated internalization and uptake via transferrin receptor binding epitopes.

The exon-skipping oligonucleotides comprise phosphorodiamidate morpholino oligomers (PMO). Each oligonucleotide is 30 nucleotides in length and comprises a region of complementarity complementary to the annealing site of an oligonucleotide consisting of SEQ ID NO: 195; in one implementation, the PMO comprises the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296).

For each complex, each oligonucleotide is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence. The linker chemistry includes a triazole covalently connected between the valine-citrulline sequence and the lysine residue. The compositions are used in treating Duchenne muscular dystrophy by inducing exon skipping, including exon 51 skipping of DMD pre-mRNA in a muscle cell of a subject, through administration of the composition.

Claims Coverage

The provided claim set includes four independent claims. Across these independent claims, the inventive coverage centers on anti-TfR1 antibody-PMO exon-skipping complexes with defined TfR1 binding range, covalent 5′ attachment to antibody lysine via a cleavable valine-citrulline linker, and treatment methods for Duchenne muscular dystrophy based on administering those complexes.

Anti-transferrin receptor antibody covalently linked to exon-skipping PMO

A composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide.

Specified anti-TfR1 binding range with human or humanized framework regions

The anti-transferrin receptor antibody comprises human or humanized framework regions and binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1.

30-nucleotide PMO with complementary region or defined PMO sequence

Each oligonucleotide is 30 nucleotides in length and comprises a region of complementarity complementary to the annealing site of an oligonucleotide consisting of SEQ ID NO: 195, and in one independent claim each oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296).

Covalent 5′ attachment via cleavable valine-citrulline linker to antibody lysine

For each complex, each oligonucleotide is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.

Treating Duchenne muscular dystrophy by administering the complexes

A method of treating Duchenne muscular dystrophy in a subject in need thereof, comprising administering a composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide, with the same antibody, PMO, and linker features.

Overall, the independent claims cover compositions and treatment methods where an anti-TfR1 antibody with human or humanized framework regions and a defined TfR1 binding range is covalently linked to exon-skipping PMO oligonucleotides. The PMO oligonucleotides are defined by 30-nucleotide length and complementarity, and in one independent claim by a specific PMO sequence, with covalent attachment at the PMO 5′ end to an antibody lysine via a cleavable linker comprising a valine-citrulline sequence.

Stated Advantages

Not explicitly described in patent.

Documented Applications

Treating Duchenne muscular dystrophy in a subject in need thereof by administering a composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide.

Inducing exon skipping, including exon 51 skipping of DMD pre-mRNA in a muscle cell of a subject, through administration of the composition.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.