Compounds and methods for modulating SCN2A
Inventors
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-12227746-B2
Publication Date
2025-02-18
Expiration Date
Abstract
Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in a cell or subject, and in certain instances reducing the amount of SCN2A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder. Such symptoms and hallmarks include, but are not limited to seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
Core Innovation
The disclosure relates to antisense compound or antisense oligonucleotide therapeutics that target SCN2A. The compounds are configured to reduce SCN2A RNA, and in some embodiments, reduce SCN2A protein, in connection with voltage-gated sodium channel alpha-1 subunit SCN2A and related disorders.
The core composition is an oligomeric modified oligonucleotide, including a 6-10-4 MOE gapmer architecture with defined nucleoside placements and defined internucleoside linkages. The sequence CCACGACATATTTTTCTACA (SEQ ID NO: 2510) is specified, with nucleosides 1-6 and 17-20 as 2′-MOE nucleosides, nucleosides 7-16 as 2′-β-D-deoxynucleosides, and cytosines as 5-methyl cytosine.
The disclosure further specifies modified oligonucleotide embodiments, including chemical notation defining nucleobases, sugar moieties, and linkage types, as well as a specific chemical structure or salt form. It includes pharmaceutical context using pharmaceutically acceptable carriers or diluents, including sodium salt, potassium salt, artificial CSF (aCSF), and phosphate-buffered saline (PBS).
Claims Coverage
The independent claims cover four main subject matter groups: a specifically defined 6-10-4 MOE gapmer sequence and linkage pattern, a modified oligonucleotide defined by chemical notation corresponding to SEQ ID NO: 2510, a modified oligonucleotide represented by a chemical structure or salt thereof, and methods of treating SCN2A-associated EE and DEE. In total, the inventive scope centers on four technical themes.
Sequence-defined 6-10-4 MOE gapmer with specified 2′-MOE and 2′-β-D-deoxynucleoside placement
An oligomeric compound comprising a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein nucleosides 1-6 and 17-20 are 2′-MOE nucleosides and nucleosides 7-16 are 2′-β-D-deoxynucleosides.
Position-defined phosphodiester and phosphorothioate internucleoside linkages
Internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages.
5-methyl cytosine within the MOE gapmer
Each cytosine is a 5-methyl cytosine.
Chemical-notation-defined modified oligonucleotide corresponding to SEQ ID NO: 2510
A modified oligonucleotide represented by chemical notation (SEQ ID NO: 2510), wherein A is adenine, mC is 5-methyl cytosine, G is guanine, T is thymine, e is a 2′-MOE sugar moiety, d is a 2′-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage.
Modified oligonucleotide represented by a chemical structure or salt thereof
A modified oligonucleotide represented by a chemical structure, or a salt thereof.
Treatment of SCN2A-associated EE and DEE
A method for treating Early Seizure Onset Epileptic Encephalopathy (EE) in a human subject associated with SCN2A by administering the oligomeric compound, and a method for treating Developmental and Epileptic Encephalopathy (DEE) in a human by administering the oligomeric compound to ameliorate seizures.
Taken together, the independent claims cover specifically defined SCN2A-targeting modified oligonucleotides, including a sequence-defined 6-10-4 MOE gapmer with defined 2′-MOE versus 2′-β-D-deoxynucleoside placement, a position-defined pattern of phosphodiester versus phosphorothioate internucleoside linkages, cytosines that are 5-methyl cytosines, a modified oligonucleotide represented by chemical notation, a modified oligonucleotide represented by a chemical structure or salt thereof, and methods of treating SCN2A-associated EE and DEE.
Stated Advantages
Quantified SCN2A RNA reduction in vitro and in vivo.
Reduce SCN2A RNA and, in some embodiments, reduce SCN2A protein.
Documented Applications
Treating SCN2A-associated Early Seizure Onset Epileptic Encephalopathy (EE) in a human subject by administering the disclosed oligomeric compound or modified oligonucleotide.
Treating SCN2A-associated Developmental and Epileptic Encephalopathy (DEE) in a human by administering the disclosed oligomeric compound or modified oligonucleotide to ameliorate seizures.
Pharmaceutical composition use comprising the oligomeric compound or modified oligonucleotide with a pharmaceutically acceptable diluent or carrier, including artificial CSF (aCSF) or phosphate-buffered saline (PBS).
Use of complementary modified oligonucleotides for hotspot regions for SCN2A with quantified SCN2A RNA reduction in vitro and in vivo.
Interested in licensing this patent?