Synthetic self-amplifying mRNA molecules with secretion antigen and immunomodulator
Inventors
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-12084703-B2
Publication Date
2024-09-10
Expiration Date
Abstract
Lipid nanoparticle (LNP) encapsulating self-amplifying mRNA, compositions, and methods of using the novel nucleic acid constructs and compositions are disclosed. LNP constructs include novel ionizable lipid. Novel sa-mRNA constructs encode a modified SARS-CoV-2 spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding a SARS-CoV-2 transmembrane domain and short cytosolic domain amino acids and immunomodulators. Sa-mRNAs are useful in for use as a therapeutic, diagnostic and/or prophylactic agent to mammalian cells or organs.
Core Innovation
The invention relates to in vitro methods of increasing the copy number of a nucleic acid. The nucleic acid comprises an origin of replication sequence (Ori), a first expression unit encoding a first nucleotide sequence operably linked to a first promoter, and a second expression unit encoding a second nucleotide sequence operably linked to a second promoter, wherein the first expression unit encodes a selectable marker and the second expression unit encodes a self-amplifying mRNA (sa-mRNA).
The invention further refines the system by engineering the second promoter as an engineered T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG) operably linked to a 5′ UTR, where the 5′ UTR is 3′ to SEQ ID NO: 47. The disclosure also describes modified T7 promoter and modified 5′ UTR sequences to increase full-length yield and increase transcript yield.
The invention also includes selecting and propagating workflows to increase copy number. Cells are contacted with the nucleic acid, cells that express the selectable marker are selected, the selected cells are subcultured to obtain a population of cells that express the selectable marker, and the population is propagated to increase the copy number of the nucleic acid. The disclosure further describes nucleic-acid architecture features such as linkers and modular sequence arrangements including Ori, selectable marker, promoters, 5′/3′ untranslated regions, non-structural replicase domains, optional subgenomic promoter, gene(s) of interest, and a 3′ poly-A tail.
Claims Coverage
The partial content includes three independent claims. Across these independent claims, the inventive coverage centers on an in vitro method for increasing nucleic-acid copy number using a two-expression-unit nucleic acid with Ori and selectable-marker and sa-mRNA units, cell selection using marker expression, and specific design constraints on the sa-mRNA promoter and sequence architecture.
Engineered T7 promoter operably linked to 5′ UTR for sa-mRNA expression
An in vitro method of increasing the copy number of a nucleic acid, where the nucleic acid encodes a self-amplifying mRNA (sa-mRNA) in a second expression unit operably linked to a second promoter comprising an engineered T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG) operably linked to a 5′ UTR, wherein the 5′ UTR is 3′ to SEQ ID NO: 47.
Selecting selectable-marker expressing cells to increase nucleic-acid copy number
An in vitro method comprising contacting cells with a nucleic acid encoding two expression units including a selectable marker (first expression unit) and a self-amplifying mRNA (second expression unit), selecting cells that express the selectable marker, subculturing the selected cells to obtain a population of cells that express the selectable marker, and propagating the population to increase the copy number of the nucleic acid.
Sequence identity to specified SA-mRNA reference nucleic acids
An in vitro method where the nucleic acid has at least 90% sequence identity to SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41), or T7-VEE-GFP (SEQ ID NO: 42).
Linker constraint in the nucleic acid including a specified SEQ ID NO: 45 linker
An in vitro method where the nucleic acid further comprises one or more linkers, wherein at least one of the one or more linkers comprises TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45).
Claim coverage in the partial content is directed to increasing nucleic-acid copy number using a two-unit nucleic acid with Ori plus a selectable marker unit and a sa-mRNA unit, followed by selecting marker-expressing cells, subculturing, and propagating. Independent claims further constrain the sa-mRNA promoter as an engineered T7 promoter with a specified SEQ ID NO: 47 and 5′ UTR relationship, constrain the nucleic acid to have at least 90% sequence identity to specified reference constructs, and constrain nucleic-acid architecture via one or more linkers including SEQ ID NO: 45.
Stated Advantages
In vitro methods for increasing the copy number of the nucleic acid.
increase IVT yield
reduce interferon/immunostimulation
reduce truncated abortive ssRNA transcripts
increased transcript yield
reduce interferon response
Documented Applications
vaccines and therapeutics, including delivery of sa-mRNA encoding a modified, truncated SARS-CoV-2 spike secretion antigen plus immunomodulators
diagnostics [procedural detail omitted for safety]
gene therapy/regulation [procedural detail omitted for safety]
Interested in licensing this patent?