Minimal UTR sequences
Inventors
Plank, Christian • Rudolph, Carsten • Aneja, Manish Kumar • Weiss, Ludwig
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-11981910-B2
Publication Date
2024-05-14
Expiration Date
Abstract
Described are DNA molecules which can be transcribed into an mRNA harbouring novel UTR sequences combining the advantages of being extremely short and at the same time allowing for high translation efficiencies of RNA molecules containing them. Further, described are vectors comprising such a DNA molecule and to host cells comprising such a vector. Moreover, described are corresponding RNA molecules containing such UTRs. Further, described is a pharmaceutical composition comprising the described RNA molecule and optionally a pharmaceutically acceptable carrier as well as to the use of the described UTRs for translating a coding region of an RNA molecule into a polypeptide or a protein encoded by said coding region.
Core Innovation
The invention relates to minimal 5′ UTRs for mRNA created from short promoter-derived RNA segments, including UTRs of the sequence R2-CGCCACC (SEQ ID NO:1) and R2-CNGCCACC (SEQ ID NO:2) with the nucleotide N defined at a specified position. The promoter-derived part R2 is defined as an RNA sequence corresponding to the part of a promoter region starting with the nucleotide where a DNA-dependent RNA-polymerase initiates RNA synthesis. The constructs further comprise an mRNA coding region upstream start codon that codes for a polypeptide and include a poly-A tail at the 3′ end with a length of at least 120 nucleotides.
The patent describes that extremely short UTRs maintain or improve translation efficiency relative to conventional longer UTRs, including an essential extra “C” between the promoter-derived sequence and the Kozak region and a negative impact when inserting an extra “A,” with rescue by a specific nucleotide insertion. It also describes improved expression with a TISU element defined by a sequence change (AG instead of CC). The document reports luciferase data and in vivo mouse luciferase and hematology readouts supporting improved expression for TISU/minimal-UTR architectures.
The described RNA molecules are further linked to therapy by administering therapeutically effective amounts of compositions comprising the minimal-UTR mRNA to treat a disease or disorder in a subject. The patent additionally outlines potential RNAi silencing based on complementary RNAs to the minimal-UTR sequences (SEQ ID NO:11–34), and demonstrates expression with therapeutic proteins such as EPO and OTC using minimal-UTR constructs.
Claims Coverage
Two independent claims are identified (clm-00001 and clm-00009). Each independent claim centers on administering a therapeutically effective RNA-based composition to treat a disease or disorder, with inventive features defined by specific upstream regulatory sequence architecture and, in one claim, by the promoter element used to produce the RNA transcript.
Therapeutic minimal-UTR mRNA with promoter-derived R2-CGCCACC or R2-CNGCCACC and poly-A tail
A method of treating a disease or disorder by administering a therapeutically effective amount of an RNA composition comprising an RNA molecule with a coding region (including a 5′ start codon) coding for a polypeptide and, directly upstream, a UTR selected from R2-CGCCACC (SEQ ID NO:1) or R2-CNGCCACC (SEQ ID NO:2) where R2 corresponds to a part of a promoter region starting at the nucleotide where a DNA-dependent RNA-polymerase initiates RNA synthesis, the RNA molecule comprising a poly-A tail at the 3′ end having a length of at least 120 nucleotides, and the UTR having a maximal length defined by the selected R2 (14 nucleotides for R2 of (i) or (ii), or 12 nucleotides for R2 of (iii) or (iv)).
Therapeutic mRNA transcribed from DNA with specified promoter recognized by DNA-dependent RNA polymerase and upstream R1-CGCCACC or R1-CNGCCACC
A method of treating a disease or disorder by administering a therapeutically effective amount of an mRNA which has been transcribed from a DNA molecule comprising a coding region (including a 5′ start codon) coding for a polypeptide and directly upstream a sequence selected from R1-CGCCACC (SEQ ID NO:1) or R1-CNGCCACC (SEQ ID NO:2) where the nucleotide N at position 2 of SEQ ID NO:2 is T, wherein R1 is a promoter recognized by a DNA-dependent RNA-polymerase, or a complementary strand, with the promoter selected from TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), ATTTAGGTGACACTATAGAAG (SEQ ID NO:5), or AATTAGGGCACACTATAGGGA (SEQ ID NO:6), corresponding to T7, T3, SP6, and K11 DNA-dependent RNA polymerases.
Across the independent claims, treatment is achieved by administering therapeutically effective amounts of RNA compositions in which translation-relevant upstream regulatory architecture is defined by minimal UTR sequence motifs derived from promoter-related RNA start regions, with one claim specifying UTRs built from promoter-derived R2 sequences and enforced maximal UTR length with a defined poly-A tail, and the other claim specifying that the mRNA is transcribed from DNA templates containing promoter sequences recognized by specified DNA-dependent RNA polymerases.
Stated Advantages
Extremely short UTRs maintain or improve translation efficiency relative to conventional longer UTRs.
Improved expression is reported for TISU/minimal-UTR architectures.
Luciferase data and in vivo mouse luciferase and hematology readouts support improved expression.
Documented Applications
Treating a disease or disorder in a subject by administering therapeutically effective amounts of minimal-UTR mRNA compositions.
RNAi silencing based on complementary RNAs to the minimal-UTR sequences (SEQ ID NO:11–34).
Expression with therapeutic proteins such as EPO and OTC using minimal-UTR constructs.
Interested in licensing this patent?