Targeting technology to selectively express mRNAs in cardiomyocytes while avoiding stimulation of cardiac fibroblasts
Inventors
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-11744902-B2
Publication Date
2023-09-05
Expiration Date
Abstract
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
Core Innovation
The invention provides a process of having an mRNA selectively adsorbed and expressed in cardiomyocytes. The process couples an aptamer that selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, and administers the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA.
The aptamer and lipid nanoparticle conjugation uses a covalent coupling chemistry, including Cu-free click chemistry with dibenzylcyclooctyne and azide components. The nanoparticle surface chemistry includes polyethylene glycol that is partially replaced with modified polyethylene glycol containing a dibenzylcyclooctyne moiety, and orientation testing is described by conjugating the azide to the aptamer at either the 3' end or the 5' end.
The invention connects cardiomyocyte-selective targeting to mRNA payloads related to heart failure and provides an uptake/expression reporter approach using luciferase mRNA in mouse hearts. The payloads include Stemin (SRF-153(A3)) and YAP1(5SA), and the document further describes a formulation and assessment approach based on luciferase expression and co-localization with cardiomyocyte markers.
Claims Coverage
The document includes two independent claims: a process claim for administering an aptamer-coupled mRNA-LNP formulation for selective cardiomyocyte expression, and a conjugate claim covering the corresponding aptamer-coupled lipid nanoparticle construct. Across the independent claims, the inventive features emphasize cardiomyocyte targeting without binding fibroblasts using specified aptamer sequences, coupling the aptamer to mRNA-containing lipid nanoparticles, and administering the conjugate to a host animal under expression-suitable conditions.
Aptamer-coupled mRNA-LNP targeting cardiomyocytes without binding fibroblasts
An aptamer selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, where the aptamer has one of the following sequences: GAGAGAGTCGTGGGGTGGGGCGGGCGGCAGTG (SEQ ID NO:1); TATGGCGGACAGGGAGGACCACTCAGTTACAG (SEQ ID NO:19); and AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20).
Administering the aptamer coupled to mRNA-containing lipid nanoparticles for expression
Administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA.
Aptamer-coupled lipid nanoparticles carrying mRNA for selective cardiomyocyte adsorption and expression
A conjugate comprising an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, coupled to lipid nanoparticles containing the mRNA, where the aptamer has one of the following sequences: GAGAGAGTCGTGGGGTGGGGCGGGCGGCAGTG (SEQ ID NO:1); TATGGCGGACAGGGAGGACCACTCAGTTACAG (SEQ ID NO:19); and AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20).
Overall, claim coverage focuses on an aptamer sequence-defined targeting element that enables lipid-nanoparticle containing mRNA to be selectively adsorbed and expressed in cardiomyocytes without binding fibroblasts, implemented either as a process of administering the aptamer-coupled mRNA-LNP to a host animal for expression or as the corresponding aptamer-coupled lipid nanoparticle conjugate.
Stated Advantages
Selective adsorption and expression of mRNA in cardiomyocytes.
Aptamer does not bind to fibroblasts.
Documented Applications
Uptake/expression reporter using luciferase mRNA in mouse hearts, including assessment based on co-localization.
Interested in licensing this patent?