Method for selecting polypeptide producing cells

Inventors

Kopetzki, ErhardPloettner, Oliver

Assignees

Roche Diagnostics GmbHHoffmann La Roche Inc

Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.

Publication Number

US-11591383-B2

Patent

Publication Date

2023-02-28

Expiration Date


Abstract

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Core Innovation

The disclosure describes alternatively spliced immunoglobulin heavy-chain-based nucleic acids configured to produce a polypeptide of interest in both soluble and plasma-membrane-bound forms. The constructs include immunoglobulin heavy chain CH3 or CH4 sequence context linked to a transmembrane domain exon arrangement, with alternative splicing controlling the soluble versus plasma-membrane-bound isoform output.

A central design aspect is the modification of the 3′ splice acceptor region in intron 6 (heavy chain) to control the soluble to plasma-membrane-bound splicing ratio in CHO cells. The constructs use a splice donor/acceptor architecture that includes a 5′ splice donor site and a 3′ splice acceptor site, and the transmembrane domain is encoded by the immunoglobulin heavy chain transmembrane domain exon M1 and associated transmembrane domain fragment encoding.

The disclosure further relates specific 3′ splice acceptor sequence variants (SEQ ID NOs 14, 15, 29–32) to distinct splicing outcomes, including a strong preference for soluble versus membrane-bound forms. Stably transfected cells are characterized for isoform ratios by Northern blot using probe-specific hybridization, and downstream comparison is made between productivity associated with this design and standard selectable marker strategies.

Claims Coverage

The partial content provides two independent nucleic-acid claims with multiple dependent refinements for one of the independent claims. Across the independent claims, the coverage includes inventive features centered on immunoglobulin heavy-chain splice donor/acceptor architecture for soluble versus plasma-membrane-bound expression and precise 3′ splice acceptor sequence constraints.

Immunoglobulin heavy-chain splice donor/acceptor construct with in-frame stop and polyadenylation

A nucleic acid having, in 5′ to 3′ direction, a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon; a second nucleic acid fragment beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1, comprising in frame translational stop codon and a polyadenylation signal; and a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus a sequence selected from SEQ ID NO: 29, SEQ ID NO: 14, or SEQ ID NO: 31.

Overlapping splice/terminal sequence spanning second and third fragments

A nucleic acid having, in 5′ to 3′ direction, a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon; a second nucleic acid fragment beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1, comprising in frame translational stop codon and a polyadenylation signal; and a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain; wherein the nucleotide sequence CTACCACCCCCTTCCTGTCCAGAGCTG (SEQ ID NO: 30) or TGACCACGCCAATCGTGTCCAGAGCTG (SEQ ID NO: 15) or CTACCACGCCAATCGTGTCCAGAGCTG (SEQ ID NO: 32) overlaps the second nucleic acid fragment and the third nucleic acid fragment.

Overall, claim coverage is directed to alternatively spliceable immunoglobulin heavy-chain-based nucleic acids that incorporate defined splice donor/acceptor junctions leading into a transmembrane domain exon M1, together with in-frame stop and polyadenylation signals. The independent claims further constrain specific nucleotide sequences at the 3′ terminus and/or overlapping regions (SEQ ID NOs 14, 15, 29–32), and dependent claims refine structural splice-site and transmembrane exon-fusion relationships and add elements such as selectable marker placement and selection based on soluble versus plasma-membrane-bound immunoglobulin.

Stated Advantages

Control of the soluble to plasma-membrane-bound splicing ratio in CHO cells.

A strong preference for soluble versus plasma-membrane-bound splicing outcomes (e.g., ~90:10 soluble:membrane-bound preference) as related to particular splice acceptor variants.

Improved productivity comparisons versus standard selectable marker strategies, as described in the partial content.

Documented Applications

Alternative splicing in CHO cells to produce and quantify soluble immunoglobulin and plasma-membrane-bound immunoglobulin, including characterizing isoform ratios by Northern blot and using selection tied to plasma-membrane-bound immunoglobulin.

Stable transfection and selection of eukaryotic cells based on plasma-membrane-bound immunoglobulin produced via alternative splicing.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.