Minimal UTR sequences
Inventors
Plank, Christian • Rudolph, Carsten • Aneja, Manish Kumar • Weiss, Ludwig
Assignees
Interested in licensing this patent?
MTEC can help explore whether this patent might be available for licensing for your application.
Publication Number
US-11352638-B2
Publication Date
2022-06-07
Expiration Date
Abstract
Described are DNA molecules which can be transcribed into an mRNA harbouring novel UTR sequences combining the advantages of being extremely short and at the same time allowing for high translation efficiencies of RNA molecules containing them. Further, described are vectors comprising such a DNA molecule and to host cells comprising such a vector. Moreover, described are corresponding RNA molecules containing such UTRs. Further, described in a pharmaceutical composition comprising the described RNA molecule are optionally a pharmaceutically acceptable carrier as well as to the use of the described UTRs for translating a coding region of an RNA molecule into a polypeptide or a protein encoded by said coding region.
Core Innovation
The invention relates to minimal UTR designs for mRNA and corresponding DNA templates that are transcribed into mRNA. The constructs include a coding region with a start codon at the 5′ end and a directly upstream sequence linked to CNGCCACC (SEQ ID NO:2). The designs place sequence constraints on the nucleotide N at position 2 of SEQ ID NO:2 and use promoter-initiated upstream sequence portions corresponding to a promoter region where RNA synthesis is initiated by a DNA-dependent RNA-polymerase.
For the DNA molecule, the upstream element is a promoter sequence R1 directly linked to CNGCCACC (SEQ ID NO:2), where the nucleotide N at position 2 of SEQ ID NO:2 is T, and R1 is recognized by a DNA-dependent RNA-polymerase. The promoter is selected from TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), ATTTAGGTGACACTATAGAAG (SEQ ID NO:5), or AATTAGGGCACACTATAGGGA (SEQ ID NO:6), and the DNA molecule can be provided as one strand or as a complementary strand.
For the RNA molecule, the upstream element is a UTR of sequence R2-CNGCCACC (SEQ ID NO:2), where the nucleotide N at position 2 of SEQ ID NO:2 is U. R2 is selected from RNA sequence variants corresponding to a promoter region beginning with the nucleotide where the DNA-dependent RNA-polymerase initiates RNA synthesis. The RNA molecule further comprises a poly-A tail at the 3′ end having a length of at least 120 nucleotides, and the UTR has defined maximal lengths depending on the selected R2 variant.
The stated problem addressed is achieving very short UTRs while maintaining or improving translation efficiency in mRNA. The description further supports the approach with luciferase SNIM mRNAs and in vivo mouse luciferase studies, and also reports expression with EPO and OTC, including the observation that no significant blood parameter differences were noted.
Claims Coverage
The document contains two independent claims that each define a minimal UTR-based nucleic acid construct with defined upstream sequence constraints and maximum UTR length behavior, including specific promoter/RNA-polymerase recognition options and poly-A tail and start-codon requirements. Each independent claim is further supported by dependent claims that add optional kit/vector/host cell/composition context and (for the RNA claim) translation and pharmaceutical-composition use contexts.
DNA molecule with promoter R1 linked to CNGCCACC and nucleotide constraint N=T
A DNA molecule transcribable into an mRNA, comprising one strand (or a complementary strand) with a coding region including a 5′ start codon, and a directly upstream sequence R1 directly linked to CNGCCACC (SEQ ID NO:2) wherein the nucleotide N at position 2 of SEQ ID NO:2 is T; the promoter R1 is recognized by a DNA-dependent RNA-polymerase.
Promoter selection recognized by DNA-dependent RNA-polymerase for R1
The promoter R1 recognized by a DNA-dependent RNA-polymerase is selected from TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), ATTTAGGTGACACTATAGAAG (SEQ ID NO:5), or AATTAGGGCACACTATAGGGA (SEQ ID NO:6).
RNA molecule with UTR R2-CNGCCACC, nucleotide constraint N=U, and poly-A tail
An RNA molecule comprising a coding region with a 5′ start codon and a directly upstream UTR of sequence R2-CNGCCACC (SEQ ID NO:2) wherein the nucleotide N at position 2 of SEQ ID NO:2 is U; R2 corresponds to a promoter region starting with the nucleotide where a DNA-dependent RNA-polymerase initiates RNA synthesis; and the RNA comprises a poly-A tail at the 3′ end having a length of at least 120 nucleotides.
Maximal UTR length thresholds based on R2 variant selection
The UTR as defined has a maximal length of 14 nucleotides when R2 is (i) or (ii), and has a maximal length of 12 nucleotides when R2 is (iii) or (iv), where R2 is selected from GGGAGA (SEQ ID NO:7), GGGAGA (SEQ ID NO:8), GAAG (SEQ ID NO:9), or GGGA (SEQ ID NO:10).
Overall, claim coverage centers on minimal UTR mRNA designs where a defined upstream promoter/RNA-polymerase-derived element is directly linked to CNGCCACC with an explicit nucleotide constraint (T in the DNA template; U in the RNA), with a poly-A tail of at least 120 nucleotides for the RNA molecule and defined maximal UTR length thresholds depending on the R2 variant.
Stated Advantages
Maintaining or improving translation efficiency while using very short UTRs.
Documented Applications
Use of the DNA molecule and RNA molecule in vectors and host cells.
RNA-based therapies via pharmaceutical compositions that include the RNA molecule.
Translating a coding region of the RNA molecule into a polypeptide or protein using the defined UTR constructs.
Expression studies using luciferase SNIM mRNAs in A549 and HepG2, and in vivo mouse luciferase studies (Balb/c mice).
Expression with EPO and OTC.
Interested in licensing this patent?