Antisense oligonucleotide modulators of serotonin receptor 2C and uses thereof

Inventors

Stamm, StefanShen, ManliJosiah, Serene

Interested in licensing this patent?

MTEC can help explore whether this patent might be available for licensing for your application.

Assignees

Takeda Pharmaceutical Co Ltd

Member
University of Kentucky
University of Kentucky

The Office of Sponsored Projects Administration (OSPA) at the University of Kentucky is dedicated to transforming tomorrow by streamlining grants and contracts. OSPA provides essential services to faculty and staff, including assistance with proposal preparation, award negotiation, and compliance with sponsor policies.

Publication Number

US-10415039-B2

Patent

Publication Date

2019-09-17

Expiration Date

2032-11-09


Abstract

The present invention provides, among other things, oligonucleotide modulators of human 5′-HT2C receptor (HTR2C) and improved methods and composition for treating HTR2C-related diseases, disorders or conditions based on such modulators. In particular, oligonucleotides modulators according to the invention target specific regions in the Exon V/Intron V junction of the human HTR2C pre-mRNA and drive expression of HTR2C Vb splice isoform, leading to increased generation of non-edited strong HTR2C receptor and enhanced serotonin receptor activity.

Core Innovation

The invention provides antisense oligonucleotide modulators targeted to the human 5′-HT2C receptor (HTR2C) pre-mRNA, specifically designed to promote Exon Vb inclusion and drive the expression of the HTR2C Vb splice isoform. These oligonucleotides hybridize to regions at the Exon V/Intron V junction, resulting in increased levels of the non-edited strong serotonin receptor, which leads to enhanced serotonin receptor activity.

This advancement addresses the challenges in treating HTR2C-related diseases, disorders, or conditions, such as obesity and Prader-Willi Syndrome (PWS). Prior pharmaceutical HTR2C agonists directly targeted the HTR2C protein and were ineffective or unsafe in cases where the receptor was dramatically reduced or absent, as in PWS, or led to side effects due to non-specific receptor activation.

The disclosed antisense oligonucleotides serve as genetic agonists by modifying the splicing of HTR2C pre-mRNA, enabling the production of the active receptor isoform even in cellular environments deficient in traditional RNA processing. Experimental evidence demonstrates efficacy both in vitro and in vivo, showing increased HTR2C Vb isoform expression, successful CNS delivery to hypothalamic neurons, and consequent reduction in food intake in animal models, supporting their use for conditions involving HTR2C dysfunction.

Claims Coverage

The patent claims center on one independent inventive feature concerning antisense oligonucleotides that target specific regions of the human 5′-HT2C receptor (HTR2C) pre-mRNA.

Modulation of HTR2C activity via exon Vb-targeting antisense oligonucleotides

The method involves delivering to a cell an antisense oligonucleotide of 10–50 nucleotides in length that specifically hybridizes, under stringent conditions, to a target region of human HTR2C pre-mRNA comprising the sequence 5′ UUGGCCAUAAGAAUUGCAGCGGCUAUGCUCAAUACU 3′ (SEQ ID NO: 1). The oligonucleotide must have a sequence at least 95% identical to 18 or more contiguous nucleotides from this region. Key inventive features include: - Targeting the Exon V/Intron V junction of HTR2C pre-mRNA for specific modulation. - Promotion of the HTR2C Vb splice isoform through oligonucleotide-induced splicing changes. - Sequences specified or exemplified include, but are not limited to, 5′ AGUAUUGAGCAUAGCCGC 3′ (SEQ ID NO: 5), 5′ UGCAAUUCUUAUGGCCAA 3′ (SEQ ID NO: 8), and related oligonucleotides. - Application of stringent hybridization conditions (such as 50% formamide, 1 mg heparin at 42°C, and washes at 65°C) to ensure specificity. - Delivery to neurons, including those of the hypothalamus, as explicitly stated.

The inventive coverage is focused on the composition and use of antisense oligonucleotides that specifically modulate HTR2C splicing by hybridizing to defined pre-mRNA regions, promoting Exon Vb inclusion and increased functional receptor expression.

Stated Advantages

Antisense oligonucleotides according to the invention can effectively drive the expression of the HTR2C Vb splice isoform, leading to increased production of the strong, non-edited serotonin receptor.

These oligonucleotides can enhance serotonin receptor activity in various cells and tissues, including neurons.

The invention provides therapeutic tools for diseases that cannot be addressed by traditional HTR2C protein agonists, such as Prader-Willi Syndrome, where the receptor is significantly reduced or absent.

In vivo delivery to the brain, specifically to hypothalamic neurons, is feasible and effective for reducing food intake in treated animals.

Documented Applications

Treatment of hyperphagia by administering antisense oligonucleotides targeting HTR2C pre-mRNA.

Treatment of obesity via modulation of HTR2C activity with antisense oligonucleotides.

Treatment of Prader-Willi Syndrome through delivery of antisense oligonucleotides that increase active HTR2C receptor expression.

Treatment of diseases, disorders, or conditions associated with HTR2C dysfunction, including psychiatric disorders (e.g., schizophrenia, depression, suicidal tendencies, bipolar disorder), epilepsy, addictive disorders, sleep disorders, diabetes, and autonomic dysregulation.

JOIN OUR MAILING LIST

Stay Connected with MTEC

Keep up with active and upcoming solicitations, MTEC news and other valuable information.